Eif5b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eif5b^em1(IMPC)J
• Name: eukaryotic translation initiation factor 5B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324040
• Synonyms: Eif5b^-
• Gene: Eif5b Location: Chr1:38037091-38094660 bp, + strand Genetic Position: Chr1, 16.4 cM
• Alliance: Eif5b^em1(IMPC)J page
• IMPC: Eif5b gene page

Eif5b^em1(IMPC)J/Eif5b^em1(IMPC)J mice exhibit embryonic lethality, with no embryos detected at E7.5 and lower number of embryos than expected at E3.5 that appear as morulae. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGAAGGCTCTGGTTCATGTT and GTCATCCCTTAAAGGTCATG that targeted exon(s) ENSMUSE00000340970.3. This resulted in deletion(s) of 800 bp (location: Chr1:38057853-38058652; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eif5b Mutation: 67 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)