About   Help   FAQ
Eif5bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Eif5bem1(IMPC)J
Name: eukaryotic translation initiation factor 5B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6324040
Synonyms: Eif5b-
Gene: Eif5b  Location: Chr1:38037091-38094660 bp, + strand  Genetic Position: Chr1, 16.4 cM
Alliance: Eif5bem1(IMPC)J page
IMPC: Eif5b gene page
Eif5bem1(IMPC)J/Eif5bem1(IMPC)J mice exhibit embryonic lethality, with no embryos detected at E7.5 and lower number of embryos than expected at E3.5 that appear as morulae. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCATCCCTTAAAGGTCATG and AGAAGGCTCTGGTTCATGTT, which resulted in a 800 bp deletion beginning at Chromosome 1 position 38,018,772 bp and ending after 38,019,571 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340970 (exon 4) and 130 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 75 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Eif5b Mutation:  67 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory