About   Help   FAQ
Nsl1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nsl1em1(IMPC)J
Name: NSL1, MIS12 kinetochore complex component; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6317375
Synonyms: Nsl1-
Gene: Nsl1  Location: Chr1:190794710-190816755 bp, + strand  Genetic Position: Chr1, 96.28 cM
Alliance: Nsl1em1(IMPC)J page
IMPC: Nsl1 gene page
Nsl1em1(IMPC)J/Nsl1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 72hr in vitro, never forming blastocysts.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCAGTGCGGAGATGAGGG and TAGACCTGAGGCAAATGCTG, which resulted in a 483 bp deletion beginning at Chromosome 1 position 191,069,888 bp and ending after 191,070,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000461366 (exon 3) and 352 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nsl1 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory