Nsl1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nsl1^em1(IMPC)J
• Name: NSL1, MIS12 kinetochore complex component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6317375
• Synonyms: Nsl1^-
• Gene: Nsl1 Location: Chr1:190794710-190816755 bp, + strand Genetic Position: Chr1, 96.28 cM
• Alliance: Nsl1^em1(IMPC)J page
• IMPC: Nsl1 gene page

Nsl1^em1(IMPC)J/Nsl1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 72hr in vitro, never forming blastocysts.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AATCAGTGCGGAGATGAGGG and TAGACCTGAGGCAAATGCTG that targeted exon(s) ENSMUSE00000461366.3. This resulted in deletion(s) of 483 bp (location: Chr1:190802085-190802567; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nsl1 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)