About   Help   FAQ
Bltp3bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Bltp3bem1(IMPC)J
Name: bridge-like lipid transfer protein family member 3B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6317373
Gene: Bltp3b  Location: Chr10:89580853-89655733 bp, + strand  Genetic Position: Chr10, 45.22 cM, cytoband C2
Alliance: Bltp3bem1(IMPC)J page
IMPC: Bltp3b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGTGAGTCTACAGTTTGG and ACTCGGCTTCAATAGATACT, which resulted in a 641 bp deletion beginning at Chromosome 10 position 89,772,175 bp and ending after 89,772,815 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000574231 (exon 4) and 549 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 82. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Bltp3b Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory