About   Help   FAQ
Smim20em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Smim20em1(IMPC)J
Name: small integral membrane protein 20; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6317363
Synonyms: Smim20 KO
Gene: Smim20  Location: Chr5:53424448-53435882 bp, + strand  Genetic Position: Chr5, 29.05 cM
Alliance: Smim20em1(IMPC)J page
IMPC: Smim20 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGGGTGTGACATTACAAG and TACAAATAGCTATTACTACA, which resulted in a 1929 bp deletion beginning at Chromosome 5 position 53,276,856 bp and ending after 53,278,784 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254968 and ENSMUSE00000766691 (exons 2 and 3) and 1228 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 2 amino acids later. There is a 2 bp TG insertion at the deletion site. RT-qPCR analysis demonstrated the absence of Smim20 mRNA expression in the hypothalamus of homozygous mutant females. (J:188991, J:350521, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Smim20 Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory