Smim20em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Smim20em1(IMPC)J |
Name: |
small integral membrane protein 20; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6317363 |
Synonyms: |
Smim20 KO |
Gene: |
Smim20 Location: Chr5:53424448-53435882 bp, + strand Genetic Position: Chr5, 29.05 cM
|
Alliance: |
Smim20em1(IMPC)J page
|
IMPC: |
Smim20 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGGGTGTGACATTACAAG and TACAAATAGCTATTACTACA, which resulted in a 1929 bp deletion beginning at Chromosome 5 position 53,276,856 bp and ending after 53,278,784 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254968 and ENSMUSE00000766691 (exons 2 and 3) and 1228 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 2 amino acids later. There is a 2 bp TG insertion at the deletion site. RT-qPCR analysis demonstrated the absence of Smim20 mRNA expression in the hypothalamus of homozygous mutant females.
(J:188991, J:350521)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|