About   Help   FAQ
Mbipem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mbipem1(IMPC)J
Name: MAP3K12 binding inhibitory protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6317348
Synonyms: Mbip-
Gene: Mbip  Location: Chr12:56375091-56392681 bp, - strand  Genetic Position: Chr12, 24.3 cM
Alliance: Mbipem1(IMPC)J page
IMPC: Mbip gene page
Mbipem1(IMPC)J/Mbipem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida but form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTCACCTTCACTTTCTAA and TTAGTAACTTTGAGCAAAAT, which resulted in a 2527 bp deletion beginning at Chromosome 12 position 56,339,932 bp and ending after 56,342,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314161 through ENSMUSE00000114025 (exons 2 through 4) and 2091 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 20 amino acids later. There is a 1 bp insertion (G) at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mbip Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory