Mbipem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Mbipem1(IMPC)J |
Name: |
MAP3K12 binding inhibitory protein 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6317348 |
Synonyms: |
Mbip- |
Gene: |
Mbip Location: Chr12:56375091-56392681 bp, - strand Genetic Position: Chr12, 24.3 cM
|
Alliance: |
Mbipem1(IMPC)J page
|
IMPC: |
Mbip gene page |
|
Mbipem1(IMPC)J/Mbipem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida but form irregular outgrowths.
Show the 1 phenotype image(s) involving this allele.
|
|
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTCACCTTCACTTTCTAA and TTAGTAACTTTGAGCAAAAT, which resulted in a 2527 bp deletion beginning at Chromosome 12 position 56,339,932 bp and ending after 56,342,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314161 through ENSMUSE00000114025 (exons 2 through 4) and 2091 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 20 amino acids later. There is a 1 bp insertion (G) at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|