Mbip^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mbip^em1(IMPC)J
• Name: MAP3K12 binding inhibitory protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6317348
• Synonyms: Mbip^-
• Gene: Mbip Location: Chr12:56375091-56392681 bp, - strand Genetic Position: Chr12, 24.3 cM
• Alliance: Mbip^em1(IMPC)J page
• IMPC: Mbip gene page

Mbip^em1(IMPC)J/Mbip^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida but form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GGTTCACCTTCACTTTCTAA and TTAGTAACTTTGAGCAAAAT that targeted exon(s) ENSMUSE00000114023.4 ENSMUSE00000114025.4 ENSMUSE00000314161.4. This resulted in deletion(s) of 2527 bp (location: Chr12:56386717-56389243; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mbip Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)