About   Help   FAQ
Rcor3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rcor3em1(IMPC)J
Name: REST corepressor 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6317336
Gene: Rcor3  Location: Chr1:191782846-191822359 bp, - strand  Genetic Position: Chr1, 97.23 cM
Alliance: Rcor3em1(IMPC)J page
IMPC: Rcor3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATGGAACCAGGCCTCACG and TTAGTAAAGGTACCACGACA, which resulted in a 474 bp deletion beginning at Chromosome 1 position 192,124,003 bp and ending after 192,124,476 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000504238 (exon 6) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 170. There is a 1 bp insertion C at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rcor3 Mutation:  38 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory