About   Help   FAQ
Ttc29em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttc29em1(IMPC)J
Name: tetratricopeptide repeat domain 29; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6317331
Gene: Ttc29  Location: Chr8:78939926-79120955 bp, + strand  Genetic Position: Chr8, 36.86 cM
Alliance: Ttc29em1(IMPC)J page
IMPC: Ttc29 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCCATTTTAGACCAGAGAG and GTTCAACCTATTCCACTGAG, which resulted in a 383 bp deletion beginning at Chromosome 8 position 78,246,056 bp and ending after 78,246,438 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000249377 (exon 6) and 159 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 2 amino acids later. There is a 1 bp (T) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ttc29 Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory