Ttc29em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ttc29em1(IMPC)J |
| Name: |
tetratricopeptide repeat domain 29; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6317331 |
| Gene: |
Ttc29 Location: Chr8:78939926-79120955 bp, + strand Genetic Position: Chr8, 36.86 cM
|
| Alliance: |
Ttc29em1(IMPC)J page
|
| IMPC: |
Ttc29 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCCATTTTAGACCAGAGAG and GTTCAACCTATTCCACTGAG, which resulted in a 383 bp deletion beginning at Chromosome 8 position 78,246,056 bp and ending after 78,246,438 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000249377 (exon 6) and 159 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 2 amino acids later. There is a 1 bp (T) insertion at the deletion site.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|