About   Help   FAQ
Ino80cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ino80cem1(IMPC)J
Name: INO80 complex subunit C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6316629
Gene: Ino80c  Location: Chr18:24237818-24254876 bp, - strand  Genetic Position: Chr18, 12.74 cM
Alliance: Ino80cem1(IMPC)J page
IMPC: Ino80c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTATGTCTCTCTAGACAGA and CCCGCCTTACAGAAAATGGA, which resulted in a 2807 bp deletion beginning at Chromosome 18 position 24,111,655 bp and ending after 24,114,461 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222154, ENSMUSE00000365673 (exon 2-4) and 2516 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 a deletion of 97 amino acids and then returns in frame for an additional 43 amino acid. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ino80c Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory