Ulk3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ulk3^em1(IMPC)Tcp
• Name: unc-51-like kinase 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316228
• Gene: Ulk3 Location: Chr9:57496735-57503516 bp, + strand Genetic Position: Chr9, 31.09 cM, cytoband C
• Alliance: Ulk3^em1(IMPC)Tcp page
• IMPC: Ulk3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0440 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATCAACGAGGCATCCGGATT and TTTGAAGGGGCCGACCCCAT targeting the 5' side and GACTTAACAGAGCGACCCCT and GAGCTGAGCCCGGCGCCAAA targeting the 3' side of exons ENSMUSE00000258949, ENSMUSE00000218586, and ENSMUSE00000258920 (exons 2-4) resulting in a 1,210-bp deletion of Chr9 from 57590273 to 57591482 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ulk3 Mutation: 23 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)