About   Help   FAQ
Rnf135em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf135em2(IMPC)Tcp
Name: ring finger protein 135; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316209
Gene: Rnf135  Location: Chr11:80074677-80090583 bp, + strand  Genetic Position: Chr11, 47.59 cM, cytoband B5
Alliance: Rnf135em2(IMPC)Tcp page
IMPC: Rnf135 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0621 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTCTGACTTGTGTACTCAGG and TTGGAACAGGGCTCACACGT targeting the 5' side and GGCCATTCCCACCCAATCAG and TGATCCCTAATCCTAGTTTA targeting the 3' side of exon ENSMUSE00000108337 resulting in a 2,115-bp deletion of Chr11 from 80192852 to 80194966_insAAGGCA & a 390-bp deletion of Chr11 from 80195037 to 80195426 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rnf135 Mutation:  41 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory