Mvk^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mvk^em2(IMPC)Tcp
• Name: mevalonate kinase; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316199
• Gene: Mvk Location: Chr5:114582330-114598652 bp, + strand Genetic Position: Chr5, 55.99 cM
• Alliance: Mvk^em2(IMPC)Tcp page
• IMPC: Mvk gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0322 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ATAGGTGACTTAGCCTGACG and AGCCTCACCAACACGGGCAA resulting in a deletion of 666-bp from Chr5 from 114452050 to 114452715 witgh an insertion of a single T at the junction (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mvk Mutation: 19 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)