About   Help   FAQ
Fmnl2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Fmnl2em1(IMPC)Tcp
Name: formin-like 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6316180
Gene: Fmnl2  Location: Chr2:52747872-53023816 bp, + strand  Genetic Position: Chr2, 30.69 cM
Alliance: Fmnl2em1(IMPC)Tcp page
IMPC: Fmnl2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project TCPR0254 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and two guide single RNAs with spacer sequences of TCCTCGATGGACCTGCTCCA and GGCAACAGTGTGTCCCGCTC resulting in a 28-bp deletion of Chr2:53054513-53054540 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fmnl2 Mutation:  262 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory