About   Help   FAQ
Cdyl2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdyl2em1(IMPC)Tcp
Name: chromodomain protein, Y chromosome-like 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6316169
Gene: Cdyl2  Location: Chr8:117301139-117459730 bp, - strand  Genetic Position: Chr8, 63.15 cM, cytoband E1
Alliance: Cdyl2em1(IMPC)Tcp page
IMPC: Cdyl2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1032 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) with spacer sequences of TCCGGGAGGATGACGAGTCC targeting the 5' side and TGGTGAGTTAGCAACACGCC targeting the 3' side of a critical exon. This resulted in a 596-bp del Chr8: 116594751 to 116595346 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cdyl2 Mutation:  86 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory