Alg6^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alg6^em2(IMPC)Tcp
• Name: ALG6 alpha-1,3-glucosyltransferase; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316161
• Gene: Alg6 Location: Chr4:99603901-99651697 bp, + strand Genetic Position: Chr4, 45.71 cM
• Alliance: Alg6^em2(IMPC)Tcp page
• IMPC: Alg6 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0837 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with 4 guide RNAs with spacer sequences of GGACATTTGGAGTATCCAGA and GTGCTCTTGCCGCTTTGAGT targeting the 5' side GGTCTTATTCTTATCGACTA and CCTAGATCATAATATGTAAC targeting the 3' side of exons ENSMUSE00001275430 and ENSMUSE00001257593 resulting in a 1431-bp deletion Chr4: 99740974 to 99742404; 20-bp deletion Chr4:99740914 to 99740932_insCCA; Chr4:99742454_insA (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Alg6 Mutation: 28 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)