Adamtsl3^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adamtsl3^em2(IMPC)Tcp
• Name: ADAMTS-like 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316160
• Synonyms: Adamts13^em2(IMPC)Tcp
• Gene: Adamtsl3 Location: Chr7:81984902-82263658 bp, + strand Genetic Position: Chr7, 47.18 cM
• Alliance: Adamtsl3^em2(IMPC)Tcp page
• IMPC: Adamtsl3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR837 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNA(s) with spacer sequences of CACTTTAATCTAAGGCAAGA and GATTGCTGTAGGGCCATTGC targeting the 5' side and GTGATACCTACAGCATTCGG and GGTAGGACTTGTCTAAACAC targeting the 3' side of exon ENSMUSE00000591449 resulting in a 218-bp deletion Chr7:82575906 to 82576123_insTGTGGTGCA and 21-bp deletion Chr7:82576215 to 82576235_insA (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Adamtsl3 Mutation: 88 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)