2610008E11Rik^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: 2610008E11Rik^em1(IMPC)Mbp
• Name: RIKEN cDNA 2610008E11 gene; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6316124
• Gene: 2610008E11Rik Location: Chr10:78900208-78933434 bp, - strand Genetic Position: Chr10, 39.72 cM
• Alliance: 2610008E11Rik^em1(IMPC)Mbp page
• IMPC: 2610008E11Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GTGAATCTACATTAACAAAG and TTTTAGCTGATGTGTGACAA that targeted exon(s) ENSMUSE00000575016.2 ENSMUSE00001779965.1. This resulted in deletion(s) of 2 bp (location: Chr10:78929891-78929892; GRCm39), 2 bp (location: Chr10:78929901-78929902; GRCm39), 2 bp (location: Chr10:78929921-78929922; GRCm39), 2 bp (location: Chr10:78929938-78929939; GRCm39), 3 bp (location: Chr10:78929976-78929978; GRCm39), 11 bp (location: Chr10:78930160-78930170; GRCm39), and 388 bp (location: Chr10:78930174-78930561; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any 2610008E11Rik Mutation: 33 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)