Pbld2^em5(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pbld2^em5(IMPC)Bay
• Name: phenazine biosynthesis-like protein domain containing 2; endonuclease-mediated mutation 5, Baylor College of Medicine
• MGI ID: MGI:6315516
• Gene: Pbld2 Location: Chr10:62860094-62894592 bp, + strand Genetic Position: Chr10, 32.52 cM, cytoband B4
• Alliance: Pbld2^em5(IMPC)Bay page
• IMPC: Pbld2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and the guide sequence CCAGATGCTTCGCGCCGTGGGTT, which resulted in a Point Mutation allele. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pbld2 Mutation: 41 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)