Rab28^{em2(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab28^{em2(IMPC)Wtsi}
• Name: RAB28, member RAS oncogene family; endonuclease-mediated mutation 2, Wellcome Trust Sanger Institute
• MGI ID: MGI:6315511
• Gene: Rab28 Location: Chr5:41782319-41865500 bp, - strand Genetic Position: Chr5, 22.58 cM, cytoband B2
• Alliance: Rab28^{em2(IMPC)Wtsi} page
• IMPC: Rab28 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences CTATAGTCTGTTACCTAGTA, GTTGGAGACTCACCCTCCCC, TGAGGTTATATAAGTCTCAC, and TGCAGCTCTAATCAGTCACG. This description was generated automatically. Additional molecular information for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab28 Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)