Ercc4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ercc4^em1(IMPC)J
• Name: excision repair cross-complementing rodent repair deficiency, complementation group 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314793
• Gene: Ercc4 Location: Chr16:12927548-12968481 bp, + strand Genetic Position: Chr16, 8.93 cM
• Alliance: Ercc4^em1(IMPC)J page
• IMPC: Ercc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACACTACCTGACAAGTCGAG and TTAGTAAGCTGCTTAGTACA that targeted exon(s) ENSMUSE00000798154.2 ENSMUSE00001281029.2 ENSMUSE00001953308.1. This resulted in deletion(s) of 355 bp (location: Chr16:12929553-12929907; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ercc4 Mutation: 96 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)