About   Help   FAQ
Tuba1cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tuba1cem1(IMPC)J
Name: tubulin, alpha 1C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6314751
Gene: Tuba1c  Location: Chr15:98927772-98935986 bp, + strand  Genetic Position: Chr15, 55.61 cM
Alliance: Tuba1cem1(IMPC)J page
IMPC: Tuba1c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, AAGATAGGATCACTTTTCAG and TATCATGGCAGCACTCATAG, which resulted in a 4195 bp deletion beginning at Chromosome 15 position 99,034,012 bp and ending after 99,038,208 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000972932, ENSMUSE00001011522, and ENSMUSE00000501603 (exons 2-4) and 2747 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to generate a null allele, by a change of amino acid after residue 1 and truncation 6 amino acids later, by read through. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tuba1c Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory