Papola^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Papola^em1(IMPC)J
• Name: poly (A) polymerase alpha; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314387
• Gene: Papola Location: Chr12:105750953-105805203 bp, + strand Genetic Position: Chr12, 56.06 cM, cytoband F1
• Alliance: Papola^em1(IMPC)J page
• IMPC: Papola gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAATGGTTGTTAGTAAAGCA and GAATTGTCCATAGACCACAG, which resulted in a 373 bp deletion beginning at Chromosome 12 position 105,804,899 bp and ending after 105,805,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001214864 (exon 4) and 291 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 24 amino acids later. There is a 15 bp insertion (ACTCCCAAAACCAG) at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Papola Mutation: 65 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)