Zfp52^em1(IMPV)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp52^em1(IMPV)J
• Name: zinc finger protein 52; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314267
• Gene: Zfp52 Location: Chr17:21755801-21782863 bp, + strand Genetic Position: Chr17, 11.4 cM
• Alliance: Zfp52^em1(IMPV)J page
• IMPC: Zfp52 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at The Jackson Laboratory by injecting CAS9 Protein and 2 guide sequences TTTGTAAGTACTGGCCCTATAGG, CCCTGTAGCACACCGTTGAACAA, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zfp52 Mutation: 33 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)