Zfp52^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp52^em1(IMPC)J
• Name: zinc finger protein 52; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314226
• Gene: Zfp52 Location: Chr17:21755801-21782863 bp, + strand Genetic Position: Chr17, 11.4 cM
• Alliance: Zfp52^em1(IMPC)J page
• IMPC: Zfp52 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTTCAACGGTGTGCTACA and TTTGTAAGTACTGGCCCTAT, which resulted in a 213 bp deletion beginning at Chromosome 17 position 21,557,103 bp and ending after 21,557,315 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000970551 (exon 4) and 86 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 10 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp52 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)