About   Help   FAQ
Dydc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dydc2em1(IMPC)J
Name: DPY30 domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6314223
Gene: Dydc2  Location: Chr14:40771074-40791165 bp, - strand  Genetic Position: Chr14, 22.36 cM, cytoband C1
Alliance: Dydc2em1(IMPC)J page
IMPC: Dydc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTCAGCCTCTATCAGCCAG and AACTCGCTTTAGGAAAAGAA, which resulted in a 970 bp deletion beginning at Chromosome 14 position 41,061,848 bp and ending after 41,062,817 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120891 and ENSMUSE00000120893 (exons 2 and 3) and 691 bp of flanking intronic sequence including the translation start, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dydc2 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory