About   Help   FAQ
Naa35em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Naa35em1(IMPC)J
Name: N(alpha)-acetyltransferase 35, NatC auxiliary subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6314217
Gene: Naa35  Location: Chr13:59733147-59782612 bp, + strand  Genetic Position: Chr13, 31.87 cM, cytoband B3
Alliance: Naa35em1(IMPC)J page
IMPC: Naa35 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATAATTGAAAGCATCACTG and TAGGATACTTTTCACGAAGA, which resulted in a 306 bp deletion beginning at Chromosome 13 position 59,595,218 bp and ending after 59,595,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000118943 (exon 3) and 272 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 12 amino acids later. There is a 3 bp intronic deletion (TCT) 41 bp before the larger deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Naa35 Mutation:  59 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory