Ccdc15^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc15^em1(IMPC)J
• Name: coiled-coil domain containing 15; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6314215
• Gene: Ccdc15 Location: Chr9:37187131-37259728 bp, - strand Genetic Position: Chr9, 20.74 cM
• Alliance: Ccdc15^em1(IMPC)J page
• IMPC: Ccdc15 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGACTGAAGTAACCAGTTA and AAAGTTTCGTTGTAAATATA, which resulted in a 13,775 bp deletion beginning at Chromosome 9 position 37,302,836 bp and ending after 37,316,610 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000344794-ENSMUSE00000335669 (exons 6-12) and 12,426 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 233 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc15 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)