About   Help   FAQ
Zc3h7bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zc3h7bem1(IMPC)J
Name: zinc finger CCCH type containing 7B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6314204
Gene: Zc3h7b  Location: Chr15:81629299-81680470 bp, + strand  Genetic Position: Chr15, 38.23 cM
Alliance: Zc3h7bem1(IMPC)J page
IMPC: Zc3h7b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTCTGCTCAGTTAGTCAG and TCCAACCCCCTACCCTAGCC, which resulted in a 289 bp deletion beginning at Chromosome 15 position 81,768,613 bp and ending after 81,768,901 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000253367 (exon 3) and 255 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 33 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zc3h7b Mutation:  59 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory