About   Help   FAQ
Atp13a3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Atp13a3em1(IMPC)J
Name: ATPase type 13A3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6314147
Gene: Atp13a3  Location: Chr16:30131241-30207674 bp, - strand  Genetic Position: Chr16, 21.26 cM
Alliance: Atp13a3em1(IMPC)J page
IMPC: Atp13a3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGCTCCTTTACTTCACAT and TATAGTCATGGAATAAGACT, which resulted in a 423 bp deletion beginning at Chromosome 16 position 30,356,957 bp and ending after 30,357,379 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000393476 (exon 8) and 353 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 25 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Atp13a3 Mutation:  67 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory