About   Help   FAQ
Akt3em1Shzb
Endonuclease-mediated Allele Detail
Summary
Symbol: Akt3em1Shzb
Name: Akt serine/threonine kinase 3; endonuclease-mediated mutation 1, Bridget Shafit-Zagardo
MGI ID: MGI:6313591
Synonyms: Akt3fl
Gene: Akt3  Location: Chr1:176847639-177085769 bp, - strand  Genetic Position: Chr1, 82.66 cM, cytoband H4-H6
Alliance: Akt3em1Shzb page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 endonuclease-mediated genome editing was used to insert a loxP site in intron 2 (GAGCCCATCTTCAGTCTGAC) and a second loxP site in intron 3 (CTTGCATGTTTAACTAGGGCTGG) of the gene. (J:278836)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Akt3 Mutation:  40 strains or lines available
References
Original:  J:278836 DuBois JC, et al., Akt3-Mediated Protection Against Inflammatory Demyelinating Disease. Front Immunol. 2019;10:1738
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory