About   Help   FAQ
Cfdp1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cfdp1em1(IMPC)J
Name: craniofacial development protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6307726
Gene: Cfdp1  Location: Chr8:112495123-112580923 bp, - strand  Genetic Position: Chr8, 57.98 cM
Alliance: Cfdp1em1(IMPC)J page
IMPC: Cfdp1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAACAATAGGAAGCTCCCA and GAGGTGTGTAAGGTGATCCA, which resulted in a 348 bp deletion beginning at Chromosome 8 position 111,841,722 bp and ending after 111,842,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214932 (exon 3) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation at amino acid 61. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cfdp1 Mutation:  121 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory