Nfix^em1H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nfix^em1H
• Name: nuclear factor I/X; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6307061
• Synonyms: Nfix^em3Rvt
• Gene: Nfix Location: Chr8:85431341-85527086 bp, - strand Genetic Position: Chr8, 41.02 cM, cytoband C1-C2
• Alliance: Nfix^em1H page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and a guide with spacer sequence GGTGGGTGAAAGCCATGCGT that targeted exon(s) ENSMUSE00000211773.4. This resulted in deletion(s) of 140 bp (location: Chr8:85450269-85450408; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nfix Mutation: 64 strains or lines available

References

• Original: J:343087 Kooblall KG, et al., A Mouse Model with a Frameshift Mutation in the Nuclear Factor I/X (NFIX) Gene Has Phenotypic Features of Marshall-Smith Syndrome. JBMR Plus. 2023 Jun;7(6):e10739
• All: 3 reference(s)