Nsmce4aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nsmce4aem1(IMPC)J |
| Name: |
NSE4 homolog A, SMC5-SMC6 complex component; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6307013 |
| Gene: |
Nsmce4a Location: Chr7:130134256-130149111 bp, - strand Genetic Position: Chr7, 73.19 cM
|
| Alliance: |
Nsmce4aem1(IMPC)J page
|
| IMPC: |
Nsmce4a gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGGTCTTAGAGTGTTCTA and TGAGCTCTAAGACTGGTGAG, which resulted in a 469 bp deletion beginning at Chromosome 7 position 130,542,540 bp and ending after 130,543,008 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001241414 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 16 amino acids later. There is an 8 bp insertion at the del site (AGCTAGAG).
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|