Nsmce4a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nsmce4a^em1(IMPC)J
• Name: NSE4 homolog A, SMC5-SMC6 complex component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6307013
• Gene: Nsmce4a Location: Chr7:130134256-130149111 bp, - strand Genetic Position: Chr7, 73.19 cM
• Alliance: Nsmce4a^em1(IMPC)J page
• IMPC: Nsmce4a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGGTCTTAGAGTGTTCTA and TGAGCTCTAAGACTGGTGAG, which resulted in a 469 bp deletion beginning at Chromosome 7 position 130,542,540 bp and ending after 130,543,008 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001241414 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 16 amino acids later. There is an 8 bp insertion at the del site (AGCTAGAG). (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nsmce4a Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)