About   Help   FAQ
Ppigem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ppigem1(IMPC)J
Name: peptidyl-prolyl isomerase G (cyclophilin G); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6306944
Gene: Ppig  Location: Chr2:69553152-69584356 bp, + strand  Genetic Position: Chr2, 40.95 cM
Alliance: Ppigem1(IMPC)J page
IMPC: Ppig gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCAGCAGTCAATAGGTA and GCTTCTGTACGTATGTGTCT, which resulted in a 582 bp deletion beginning at Chromosome 2 position 69,735,682 bp and ending after 69,736,263 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001290878 and ENSMUSE00001249525 (exons 8 and 9) and 412 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 126. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ppig Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory