About   Help   FAQ
Lin52em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lin52em1(IMPC)J
Name: lin-52 DREAM MuvB core complex component; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6306929
Synonyms: Lin52-
Gene: Lin52  Location: Chr12:84498196-84592919 bp, + strand  Genetic Position: Chr12, 39.22 cM
Alliance: Lin52em1(IMPC)J page
IMPC: Lin52 gene page
Lin52em1(IMPC)J/Lin52em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but no embryos seen at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTTGAGATTGCAGTTTGCC and CCTCTTTTTCGACTTGGTTT, which resulted in a 212 bp deletion beginning at Chromosome 12 position 84,459,515 bp and ending after 84,459,726 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000753116 (exon 4) and 145 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lin52 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory