About   Help   FAQ
Qrsl1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Qrsl1em1(IMPC)J
Name: glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6306906
Gene: Qrsl1  Location: Chr10:43750184-43777741 bp, - strand  Genetic Position: Chr10, 23.11 cM, cytoband B2
Alliance: Qrsl1em1(IMPC)J page
IMPC: Qrsl1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGATCTACAAACCCTAACG and GAGGAAAGTACACTTTTACA, which resulted in a 687 bp deletion beginning at Chromosome 10 position 43,884,488 bp and ending after 43,885,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289085 and ENSMUSE00001281000 (exons 6,7) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 2 amino acids later. There is a single bp (C) insertion at the deletion site. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Qrsl1 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory