Qrsl1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Qrsl1^em1(IMPC)J
• Name: glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6306906
• Gene: Qrsl1 Location: Chr10:43750184-43777741 bp, - strand Genetic Position: Chr10, 23.11 cM, cytoband B2
• Alliance: Qrsl1^em1(IMPC)J page
• IMPC: Qrsl1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGATCTACAAACCCTAACG and GAGGAAAGTACACTTTTACA, which resulted in a 687 bp deletion beginning at Chromosome 10 position 43,884,488 bp and ending after 43,885,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289085 and ENSMUSE00001281000 (exons 6,7) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 2 amino acids later. There is a single bp (C) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Qrsl1 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)