Cyp4a31^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cyp4a31^em1(IMPC)Bay
• Name: cytochrome P450, family 4, subfamily a, polypeptide 31; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6306623
• Gene: Cyp4a31 Location: Chr4:115420846-115436212 bp, + strand Genetic Position: Chr4, 53.06 cM
• Alliance: Cyp4a31^em1(IMPC)Bay page
• IMPC: Cyp4a31 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AGAGAATTAGGGCTATTAGT, CCACTCTGGGGGACATATGG, GAATAATTGACTCATTGTAG, and TTGAAAAACTCTCTCCCCCT that targeted exon(s) ENSMUSE00000968368.2 ENSMUSE00000981626.2 ENSMUSE00001001361.2 ENSMUSE00001047729.2 ENSMUSE00001086773.2 ENSMUSE00000263544.2 ENSMUSE00000461674.3 ENSMUSE00000714151.2 ENSMUSE00000985031.2 ENSMUSE00000989766.2 ENSMUSE00001000481.2 ENSMUSE00001010931.2 ENSMUSE00001039219.2 ENSMUSE00001050181.2 ENSMUSE00001069914.2 ENSMUSE00001071359.2 ENSMUSE00001080905.2 ENSMUSE00001087957.2 ENSMUSE00001278627.2 ENSMUSE00001286368.2 ENSMUSE00001295278.2 ENSMUSE00001306259.2 ENSMUSE00001674231.1 ENSMUSE00001674234.1 ENSMUSE00001674235.1 ENSMUSE00001674236.1 ENSMUSE00001674242.1 ENSMUSE00001674245.1. This resulted in deletion(s) of 4 bp (location: Chr4:115470602-115470605; GRCm39), 199 bp (location: Chr4:115426411-115426609; GRCm39), 3618 bp (location: Chr4:115426614-115430231; GRCm39), and 40112 bp (location: Chr4:115430372-115470483; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cyp4a31 Mutation: 35 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)