Kcnq5em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kcnq5em1(IMPC)Bay |
| Name: |
potassium voltage-gated channel, subfamily Q, member 5; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6306616 |
| Gene: |
Kcnq5 Location: Chr1:21468627-22032166 bp, - strand Genetic Position: Chr1, 6.67 cM, cytoband A5
|
| Alliance: |
Kcnq5em1(IMPC)Bay page
|
| IMPC: |
Kcnq5 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AAATCCATGCAGAAATATTC, ATTTAGGTCAGACATGTGCA, CTAGGGCATTTCAGAGAAAT, and TCCTATAAGTATGTAATGAG that targeted exon(s) ENSMUSE00001256878.2. This resulted in deletion(s) of 49 bp (location: Chr1:21663485-21663533; GRCm39), 380 bp (location: Chr1:21663617-21663996; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|