About   Help   FAQ
Pla2g4dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pla2g4dem1(IMPC)J
Name: phospholipase A2, group IVD; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6306480
Gene: Pla2g4d  Location: Chr2:120096347-120119678 bp, - strand  Genetic Position: Chr2, 60.31 cM
Alliance: Pla2g4dem1(IMPC)J page
IMPC: Pla2g4d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGGACCTTGGGAACAAGT and GATTCTATACATCCTTTCCA, which resulted in a 276 bp deletion beginning at Chromosome 2 position 120,283,707 bp and ending after 120,283,982 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000598028 (exon 3) and 139 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 48. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pla2g4d Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory