Pla2g4dem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Pla2g4dem1(IMPC)J |
Name: |
phospholipase A2, group IVD; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6306480 |
Gene: |
Pla2g4d Location: Chr2:120096347-120119678 bp, - strand Genetic Position: Chr2, 60.31 cM
|
Alliance: |
Pla2g4dem1(IMPC)J page
|
IMPC: |
Pla2g4d gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGGACCTTGGGAACAAGT and GATTCTATACATCCTTTCCA, which resulted in a 276 bp deletion beginning at Chromosome 2 position 120,283,707 bp and ending after 120,283,982 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000598028 (exon 3) and 139 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 48.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|