Rr70em1Rsnk
Endonuclease-mediated Allele Detail
|
Symbol: |
Rr70em1Rsnk |
Name: |
regulatory region 70; endonuclease-mediated mutation 1, James Resnick |
MGI ID: |
MGI:6306477 |
Synonyms: |
ASTerm |
Gene: |
Rr70 Location: Chr7:59662300-59669191 bp Genetic Position: Chr7, Syntenic
|
Alliance: |
Rr70em1Rsnk page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: CRISPR-targeting, using sgRNAS targeting TGGCAGGATTAGCAGTTCAG and GGACTAGAGACTCTTCCACT, inserted a floxed rabbit beta-globin transcriptional terminator sequence 28.6 kb downstream of upstream exon U1 and 14.3 kb upstream of the Snrpn promoter at the Angelman syndrome imprinting center (AS-IC). Three founders were used interchangeably.
(J:270068)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 1 strain available
Cell Lines: 0 lines available
|
Carrying any Rr70 Mutation: |
0 strains or lines available
|
|
Original: |
J:270068 Lewis MW, et al., A mouse model of Angelman syndrome imprinting defects. Hum Mol Genet. 2019 Jan 15;28(2):220-229 |
All: |
2 reference(s) |
|