About   Help   FAQ
Rr70em1Rsnk
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr70em1Rsnk
Name: regulatory region 70; endonuclease-mediated mutation 1, James Resnick
MGI ID: MGI:6306477
Synonyms: ASTerm
Gene: Rr70  Location: Chr7:59662300-59669191 bp  Genetic Position: Chr7, Syntenic
Alliance: Rr70em1Rsnk page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsCRISPR-targeting, using sgRNAS targeting TGGCAGGATTAGCAGTTCAG and GGACTAGAGACTCTTCCACT, inserted a floxed rabbit beta-globin transcriptional terminator sequence 28.6 kb downstream of upstream exon U1 and 14.3 kb upstream of the Snrpn promoter at the Angelman syndrome imprinting center (AS-IC). Three founders were used interchangeably. (J:270068)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rr70 Mutation:  0 strains or lines available
References
Original:  J:270068 Lewis MW, et al., A mouse model of Angelman syndrome imprinting defects. Hum Mol Genet. 2019 Jan 15;28(2):220-229
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory