About   Help   FAQ
P4ha3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: P4ha3em1(IMPC)J
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6306463
Gene: P4ha3  Location: Chr7:99934727-99968906 bp, + strand  Genetic Position: Chr7, 54.34 cM
Alliance: P4ha3em1(IMPC)J page
IMPC: P4ha3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGCCTCCAAACACAGGCAA and CTTTGCTTGAGGTAATGACA, which resulted in a 403 bp deletion beginning at Chromosome 7 position 100,293,665 bp and ending after 100,294,067 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001265059 (exon 3) and 179 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any P4ha3 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory