Wfdc17^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wfdc17^em1(IMPC)J
• Name: WAP four-disulfide core domain 17; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6305226
• Gene: Wfdc17 Location: Chr11:83594882-83597095 bp, + strand Genetic Position: Chr11, 51.22 cM
• Alliance: Wfdc17^em1(IMPC)J page
• IMPC: Wfdc17 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAAGTGACTTCTCTCTAAT and CTAGAAGATCACTAGGACCA, which resulted in a 492 bp deletion beginning at Chromosome 11 position 83,703,768 bp and ending after 83,704,259 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000578061 (exon 1) and 309 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wfdc17 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)