About   Help   FAQ
Mettl18em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mettl18em1(IMPC)J
Name: methyltransferase like 18; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6305181
Gene: Mettl18  Location: Chr1:163822458-163824812 bp, + strand  Genetic Position: Chr1, 71.3 cM
Alliance: Mettl18em1(IMPC)J page
IMPC: Mettl18 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCCTGTCTACAAATCTTG and CACTCCATAAACATGTTCCG, which resulted in a 1789 bp deletion beginning at Chromosome 1 position 163,995,732 bp and ending after 163,997,520 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000688041 (exon 2) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. There is a 14 bp insertion at the deletion site (GTAGTATGTAGAGTA). (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mettl18 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory