About   Help   FAQ
Pop7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pop7em1(IMPC)J
Name: processing of precursor 7, ribonuclease P family, (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6305126
Gene: Pop7  Location: Chr5:137499701-137500682 bp, - strand  Genetic Position: Chr5, 76.51 cM
Alliance: Pop7em1(IMPC)J page
IMPC: Pop7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTGATTCCCGTCATACTG and GCGAGACTTGAGGGTTCGCA, which resulted in a 1228 bp deletion beginning at Chromosome 5 position 137,501,323 bp and ending after 137,502,550 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000686426 (exon 1) and 230 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pop7 Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory