About   Help   FAQ
Retreg1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Retreg1em1(IMPC)J
Name: reticulophagy regulator 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6304302
Gene: Retreg1  Location: Chr15:25843266-25973773 bp, + strand  Genetic Position: Chr15, 9.59 cM
Alliance: Retreg1em1(IMPC)J page
IMPC: Retreg1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Modified isoform(s))
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTTTGTGATACGTACTCAA and TGGATGGCAGGGCAGTGGCG, which resulted in a 268 bp deletion beginning at Chromosome 15 position 25,894,926 bp and ending after 25,895,193 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000649912 (exon 2) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 8 amino acids later. There is a 5 bp (GTATA) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Retreg1 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory