About   Help   FAQ
Lurap1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lurap1lem1(IMPC)J
Name: leucine rich adaptor protein 1-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6304264
Gene: Lurap1l  Location: Chr4:80828923-80872538 bp, + strand  Genetic Position: Chr4, 37.91 cM
Alliance: Lurap1lem1(IMPC)J page
IMPC: Lurap1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGTATGTCACAGACAAGAA and GGCTAGTGCGGGAGAATCCG, which resulted in a 1322 bp deletion beginning at Chromosome 4 position 80,910,589 bp and ending after 80,911,910 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000405695 (exon 1) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lurap1l Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory