Ssc4dem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ssc4dem1(IMPC)J |
| Name: |
scavenger receptor cysteine rich family, 4 domains; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6302806 |
| Gene: |
Ssc4d Location: Chr5:135989074-136003389 bp, - strand Genetic Position: Chr5, 75.6 cM
|
| Alliance: |
Ssc4dem1(IMPC)J page
|
| IMPC: |
Ssc4d gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGTTGTAGATGCTAACG and CCTGTGCTGCTAGACAACGT, which resulted in a 4952 bp deletion beginning at Chromosome 5 position 135,962,986 bp and ending after 135,967,937 bp (GRCm38/mm10). This mutation deletes the last 200 bp of exon 4 and all intervening sequence through the first 249 bp of exon 9 (ENSMUSE00000686859 - ENSMUSE00000686851) including the splice acceptors and donors. There is a single bp (T) insertion at the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 103 and early truncation 62 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|