Ssc4dem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ssc4dem1(IMPC)J |
Name: |
scavenger receptor cysteine rich family, 4 domains; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6302806 |
Gene: |
Ssc4d Location: Chr5:135989074-136003389 bp, - strand Genetic Position: Chr5, 75.6 cM
|
Alliance: |
Ssc4dem1(IMPC)J page
|
IMPC: |
Ssc4d gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGTTGTAGATGCTAACG and CCTGTGCTGCTAGACAACGT, which resulted in a 4952 bp deletion beginning at Chromosome 5 position 135,962,986 bp and ending after 135,967,937 bp (GRCm38/mm10). This mutation deletes the last 200 bp of exon 4 and all intervening sequence through the first 249 bp of exon 9 (ENSMUSE00000686859 - ENSMUSE00000686851) including the splice acceptors and donors. There is a single bp (T) insertion at the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 103 and early truncation 62 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|