About   Help   FAQ
Ssc4dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ssc4dem1(IMPC)J
Name: scavenger receptor cysteine rich family, 4 domains; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6302806
Gene: Ssc4d  Location: Chr5:135989074-136003389 bp, - strand  Genetic Position: Chr5, 75.6 cM
Alliance: Ssc4dem1(IMPC)J page
IMPC: Ssc4d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGTTGTAGATGCTAACG and CCTGTGCTGCTAGACAACGT, which resulted in a 4952 bp deletion beginning at Chromosome 5 position 135,962,986 bp and ending after 135,967,937 bp (GRCm38/mm10). This mutation deletes the last 200 bp of exon 4 and all intervening sequence through the first 249 bp of exon 9 (ENSMUSE00000686859 - ENSMUSE00000686851) including the splice acceptors and donors. There is a single bp (T) insertion at the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 103 and early truncation 62 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ssc4d Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory