Tomm70aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tomm70aem1(IMPC)J |
| Name: |
translocase of outer mitochondrial membrane 70A; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6302770 |
| Synonyms: |
Tomm70a- |
| Gene: |
Tomm70a Location: Chr16:56942077-56974893 bp, + strand Genetic Position: Chr16, 34.22 cM
|
| Alliance: |
Tomm70aem1(IMPC)J page
|
| IMPC: |
Tomm70a gene page |
|
Tomm70aem1(IMPC)J/Tomm70aem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTGCCTAGTGTTCGGGA and AGAGAACAAAGTCTCAACCG, which resulted in a 496 bp deletion beginning at Chromosome 16 position 57,134,423 bp and ending after 57,134,918 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130105 (exon 3) and 369 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 169 and early truncation 7 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|