Casp3^em1Zhj
Endonuclease-mediated Allele Detail

Summary

• Symbol: Casp3^em1Zhj
• Name: caspase 3; endonuclease-mediated mutation 1, Zhengfan Jiang
• MGI ID: MGI:6296659
• Synonyms: Casp3^-
• Gene: Casp3 Location: Chr8:47070326-47092724 bp, + strand Genetic Position: Chr8, 26.39 cM
• Alliance: Casp3^em1Zhj page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with sgRNA AGTGGACTCTGGGATCTATC using CRISPR/Cas9 technology. The result was a 1 bp deletion, resulting in a knockout allele. (J:274136)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Casp3 Mutation: 32 strains or lines available

References

• Original: J:274136 Ning X, et al., Apoptotic Caspases Suppress Type I Interferon Production via the Cleavage of cGAS, MAVS, and IRF3. Mol Cell. 2019 Apr 4;74(1):19-31.e7
• All: 1 reference(s)