About   Help   FAQ
Casp2em1Zhj
Endonuclease-mediated Allele Detail
Summary
Symbol: Casp2em1Zhj
Name: caspase 2; endonuclease-mediated mutation 1, Zhengfan Jiang
MGI ID: MGI:6296658
Synonyms: Casp2-
Gene: Casp2  Location: Chr6:42241942-42259442 bp, + strand  Genetic Position: Chr6, 20.54 cM
Alliance: Casp2em1Zhj page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 2 was targeted with sgRNA AACACTGAAAAAGAATCGAG using CRISPR/Cas9 technology. The result was a 5 bp deletion, resulting in a knockout allele. (J:274136)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Casp2 Mutation:  25 strains or lines available
References
Original:  J:274136 Ning X, et al., Apoptotic Caspases Suppress Type I Interferon Production via the Cleavage of cGAS, MAVS, and IRF3. Mol Cell. 2019 Apr 4;74(1):19-31.e7
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory