About   Help   FAQ
Mtorem1Vic
Endonuclease-mediated Allele Detail
Summary
Symbol: Mtorem1Vic
Name: mechanistic target of rapamycin kinase; endonuclease-mediated mutation 1, Gabriel Victora
MGI ID: MGI:6295460
Synonyms: MtorF2108L
Gene: Mtor  Location: Chr4:148533068-148642140 bp, + strand  Genetic Position: Chr4, 78.76 cM, cytoband E1
Alliance: Mtorem1Vic page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR-targeting of exon 45 with an sgRNA (targeting GATCTCAAAGCAGCTACCCC) and an ssODN template engineered nucleotide substitutions to produce a G-to-C silent mutation creating an AfIII reaction enzyme site, C-to-A resulting in the amino acid substitution of phenylalanine with leucine at position 2108 (p.F2108L) and several silent mutations to prevent Cas9 recutting. The amino acid substitution produces rapamycin resistance in the encoded peptide. (J:259205)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mtor Mutation:  115 strains or lines available
References
Original:  J:259205 Ersching J, et al., Germinal Center Selection and Affinity Maturation Require Dynamic Regulation of mTORC1 Kinase. Immunity. 2017 Jun 20;46(6):1045-1058.e6
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory